>gi|21536448|ref|NM_002622.3| 
Homo sapiens prefoldin 1 (PFDN1), mRNA

Length=1296


Score =  392 bits (212),  Expect = 2e-107

Identities = 220/223 (98%), Gaps = 3/223 (1%)

Strand=Plus/Plus


Query  107  TCCTACCTGGAGCGAAG-GTTANAGGAAGCTGAGGACAACATCCGGGAGATGCTGATGGC  165

Sbjct  300  .................C....-.....................................  358


Query  166  ACGAAGGG-CCAGTAGGGAGCCTCTCTGGGAAGCTCTTCCTCCTGCCCCTCCCATTCCTG  224


Sbjct  359  ........C...................................................  418


Query  225  GTGGGGGCAGAGGAGTGTCTAGACATAAACAGCTTCTCCTCTGCCCCGATGGATGCTTTA  284

Sbjct  419  ............................................................  478


Query  285  TTTAGACATCCTGGCAACATCACATTTTCTGCATCACCCTGAG  327

Sbjct  479  ...........................................  521


 

bpGCsATsBinary        Primer    Reverse Complement Primer


       123456789012345678901234512345678901234567890123451234567890123456789012345

1449161110100101011101110110011AAAGTGGTGAGAATGTAAGAAGCATATGCTTCTTACATTCTCACCACTTT

14510151101001010111011101100110AAGTGGTGAGAATGTAAGAAGCATGCATGCTTCTTACATTCTCACCACTT

14610151010010101110111011001101AGTGGTGAGAATGTAAGAAGCATGATCATGCTTCTTACATTCTCACCACT

14710150100101011101110110011011GTGGTGAGAATGTAAGAAGCATGAATTCATGCTTCTTACATTCTCACCAC

14810151001010111011101100110110TGGTGAGAATGTAAGAAGCATGAAGCTTCATGCTTCTTACATTCTCACCA

14910150010101110111011001101101GGTGAGAATGTAAGAAGCATGAAGATCTTCATGCTTCTTACATTCTCACC

1509160101011101110110011011011GTGAGAATGTAAGAAGCATGAAGAATTCTTCATGCTTCTTACATTCTCAC

1519161010111011101100110110110TGAGAATGTAAGAAGCATGAAGAAGCTTCTTCATGCTTCTTACATTCTCA

15210150101110111011001101101100GAGAATGTAAGAAGCATGAAGAAGCGCTTCTTCATGCTTCTTACATTCTC

15310151011101110110011011011000AGAATGTAAGAAGCATGAAGAAGCCGGCTTCTTCATGCTTCTTACATTCT

15410150111011101100110110110001GAATGTAAGAAGCATGAAGAAGCCTAGGCTTCTTCATGCTTCTTACATTC

1559161110111011001101101100011AATGTAAGAAGCATGAAGAAGCCTTAAGGCTTCTTCATGCTTCTTACATT

1569161101110110011011011000111ATGTAAGAAGCATGAAGAAGCCTTTAAAGGCTTCTTCATGCTTCTTACAT

30210151110011101110110101010010ATTCCTTTCAATCAAGAGAGAGCAGCTGCTCTCTCTTGATTGAAAGGAAT

30310151100111011101101010100101TTCCTTTCAATCAAGAGAGAGCAGATCTGCTCTCTCTTGATTGAAAGGAA

30410151001110111011010101001011TCCTTTCAATCAAGAGAGAGCAGATATCTGCTCTCTCTTGATTGAAAGGA

30510150011101110110101010010111CCTTTCAATCAAGAGAGAGCAGATATATCTGCTCTCTCTTGATTGAAAGG


Minimum AT Length:1

Maximum AT Length:3

Minimum GC Length:1

Maximum GC Length:3


>gi|20336377|gb|AY092854.1| Myosotis alpestris NADH dehydrogenase (ndhF) gene, partial cds; chloroplast gene for chloroplast product

TAAATGTTCATTTTCAAAACTACAGTGGTAAACAAAATACCCTCTCCTATTCCCTATCTC

TATGGGGTAAAGGGGGTTCGAAAGAAAAATATTTTCGTTTGAATAATAAAAAAAATGTTT

TCTTTTTTTCACAAAAAATATATAaaagtggtgagaatgtaagaagcatgaagaagcctt

tTATTAGTATTGCTCAGTTTAAGAATAAGAATACTTATTTCTATCCTTATGAATCAGACA

ATACTATGTTACTTCCCCTAATTATATTAGGTCTATTTACTTTGTTTGTTGGATGTTTAG

GAattcctttcaatcaagagagagcagataTATTAACTAAATGGTTAGCTCCATCTATAA

ACCTTTTGAATCAAGAACCAGAAAATTCGATGGATTGGTATGAATTTTTAAAAGATGCTT

TTTTTTCAGTCAGTATAGCTTATTTCGGAATATTTTTAGCTTCCTTTTTATATAAACCTA

TTTATTCTTCTTTACAAAATTTTAATTTAATTAATTCATTTGTTAAAAGAGGTCCTAAGA

GAATTCTTTTGGACAAAATTATAAACGGTATATATGATTGGTCATATAACCGTGCTTTCA

TAGATTCTTTTTATAAAAAATATTTAACACAGGGGGTAAAGGGATTGGCCAAATTAACTC

GTTTTTTTGATCAACGAGTAATTGATGGAATTACAAATAGCATTGGGGTTTTGAGTTTTT

TTGTA